Sr25/Lr19

  • Хромосома

    7D
  • Происхождение

    Thinopyrum ponticum
  • Тест-линия

    LC-SR25-ARS

Описание гена

Sr25 расоспецифической устойчивости перенесен на длинное плечо хромосом 7D и 7A от Thinopyrum ponticum с комплексом генов устойчивости к бурой ржавчине Lr19 и геном, контролирующим желтую окраску муки. Ген Sr25 был введен в австралийские сорта пшеницы и использовался в программе селекции пшеницы CIMMYT, где одним из основных его источников является сорт Wheatear (Bariana et al., 2007). Показана повсеместная эффективность гена Sr25 по отношению к патотипам из семейства Ug99 (Singh et al., 2011). Среди отечественного материала присутствие гена Sr25 показано для линий и сортов саратовской, самарской и омской селекции (Shamanin et al. 2016).


ДНК-маркеры

Xwmc221

  • Тип ДНК-маркера

    SSR (simple sequence repeats)
  • Структура праймеров (5’ – 3’)

    F: TCCCTTGACCTTTCTCAACG
    R: TCCATTGAGTTCCATCGTGA
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (36 циклов): 94 ℃ — 30 сек. 60 ℃ — 30 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 200
    S — 220
arrow_up [#337] Created with Sketch. Наверх