Sr23/Lr16

  • Хромосома

    2BS
  • Происхождение

    Triticum aestivum
  • Тест-линия

    LC-SR25-ARS

Описание гена

Локализован на хромосоме 2BS. Этот ген полностью ассоциирован с геном Lr16. Первоначально считалось, что ген расположен в хромосоме 4B, но для установления местоположения был использован моносомный ряд Rescue, а Rescue несет реципрокную транслокацию 2B-4B относительно Chinese Spring. Sr23/Lr16 генетически независимы от Sr36 и, предположительно, удалены от него. Sr23 экспрессируется только в условиях высокой температуры и высокой интенсивности света (Luig, 1983). Тип слабой инфекции часто характеризуется только некрозом, окружающим некоторые полностью совместимые урединии. Sr23 впервые отмечен и охарактеризован у сортов мягкой пшеницы Selkirk, Exchange и Warden.

Использование в сельском хозяйстве

Не используется. Предполагается, что ген Sr23 не обеспечит значительных уровней защиты при применении в условиях с высокого инфекционного фона (McIntosh, Luig, 1973) .


ДНК-маркеры

XTaLr16_RGA266585

  • Тип ДНК-маркера

    RGA (resistance gene analog)
  • Структура праймеров (5’ – 3’)

    F—CCGTGTCGATCCCAATAATC
    R—AGCAAGGTGAGAATCGGAAA
  • Условия амплификации

    Стадия денатурация: 95 ℃ — 5 мин. Стадия отжига праймеров (36 циклов): 94 ℃ — 45 сек. 52 ℃ — 45 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 57 п.н.

Описание маркера

RGA-маркер XTaLr16_RGA266585, который отображает 1,2 сМ от Lr16, был использован для определения присутствия гена (Harrison et al., 2015). Ген Sr23 полностью ассоциирован с Lr16 (McIntosh, Luig, 1973). Маркер не является кодоминантным и имеет небольшой продукт амплификации 58 п.н.

arrow_up [#337] Created with Sketch. Наверх