Sr26

  • Хромосома

    6AL
  • Происхождение

    Agropyron elongatum
  • Тест-линия

    EAGLE-SR26.SR9G

Описание гена

Sr26 — ген, эффективный против семейства рас Ug99, перенесен от Agropyron elongatum в дистальную область длинного плеча хромосомы 6А (Knott, 1961). Транслокация 6AS.6AL-6Ae#1L заметно влияла на урожайность созданных линий и сортов, потери составляли 9 %. Sr26 использовался в качестве источника устойчивости к возбудителю стеблевой ржавчине, в основном, в Австралии, где был создан сорт Eagle. В настоящее время созданы новые линии с укороченными фрагментами транслокаций, показавшие высокие показатели качества и урожайности (Dundas et al., 2007). Таким образом, исторически сложившаяся низкая частота встречаемости гена Sr26 среди современных сортов, а создание линий с короткими чужеродными сегментами делают ген Sr26 идеальным для использования в селекционных программах.


ДНК-маркеры

Sr26#43

  • Тип ДНК-маркера

    STS (sequence tagged site)
  • Структура праймеров (5’ – 3’)

    F: CACACGTCTCGAGGAACAGA
    R: CTCGTGGGATGAAGTCCATT
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (35 циклов): 94 ℃ — 30 сек. 61 ℃ — 30 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 207

Описание маркера

Комбинация (т.е. мультиплексирование) двух доминантных ПЦР-маркеров дает диагностический кодоминантный маркер для Sr26: Sr26#43, доминантный маркер присутствия Sr26; и BE518379 доминантный маркер по отсутствию Sr26

BE518379

  • Тип ДНК-маркера

    STS (sequence tagged site)
  • Структура праймеров (5’ – 3’)

    F: GAACCTTGGCCTGAGTGCTA
    R: GCAGCCTACAGCAAGAATCC
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (35 циклов): 94 ℃ — 30 сек. 61 ℃ — 30 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    S — 303

Описание маркера

Комбинация (т.е. мультиплексирование) двух доминантных ПЦР-маркеров дает диагностический кодоминантный маркер для Sr26: Sr26#43, доминантный маркер присутствия Sr26; и BE518379 доминантный маркер по отсутствию Sr26

arrow_up [#337] Created with Sketch. Наверх