Sr2

  • Хромосома

    3BS
  • Происхождение

    Triticum turgidum
  • Тест-линия

    Pavon76

Описание гена

Данный ген является одним из наиболее важных в современной селекции на иммунитет к возбудителю стеблевой ржавчины, так как обеспечивает длительную устойчивость взрослых растений (McIntosh, 1988; Simmonds, Rajaram, 1988). В 1979 году было описано замедленное течение патогенеза P. graminis на растениях, несущих ген Sr2, что позволило отнести обеспечиваемую им устойчивость к неспецифическому типу (Hare, McIntosh, 1979). Удобным физиологическим маркером гена Sr2 является характерное почернение чешуй колоса («pseudo black chaff»). Кроме того, ассоциированным признаком, проявляющимся при тепличных температурах выше 22 °C, является хлороз листьев на стадии проростков (Brown, 1993). За исключением Канады, ген Sr2 обеспечивает эффективную устойчивость повсеместно с момента его введения в гексаплоидную пшеницу в 1920-х годах (McFadden, 1930). Во время эпифитотий в Северной Америке в 1950-х годах сорта пшеницы с геном Sr2: Regent, Renown и Redman, показали умеренную восприимчивость. Испытанные в условиях Западной Сибири сорта Pavon 76 и Buck Buck с комбинацией генов Sr2 и Sr23 показали устойчивость к возбудителю стеблевой ржавчины (Шаманин и др., 2015). Тестирование на естественном инфекционном фоне Нечерноземной зоны Российской Федерации новых линий озимой пшеницы, созданных на основе коллекций «ВИР» и «Арсенал», позволило выявить эффективное сочетание двух, трех и более генов ювенильной устойчивости (Sr22, Sr32, Sr39 и Sr40) с геном Sr2 (Лапочкина и др., 2018).


ДНК-маркеры

Xgwm533

  • Тип ДНК-маркера

    SSR (simple sequence repeats)
  • Структура праймеров (5’ – 3’)

    F: GTTTGCCTGATGATGGATGA
    R: CCGAATGCAGATTACCCTTG
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (47 циклов): 94 ℃ — 30 сек. 62 ℃ — 30 сек. 72 ℃ — 30 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 120 п.н.

Описание маркера

Считается, что микросателлитный локус Xgwm533 тесно сцеплен с геном Sr2 (Spielmeyer et. al., 2003), однако известно, что на хромосоме 3BS присутствуют два различных локуса Xgwm533, один из которых не несет ген Sr2, но дает амплификацию продукта длиной 120 п.н., характерную для локуса с геном Sr2. Результаты показали присутствие маркера Xgwm533 в 35 генотипах, но постулирование гена может быть подтверждено только после проверки родословной и обнаружения морфологического маркера на Sr2 (псевдочерная колосковая чешуя, PBC).

Sr2ger93p

  • Тип ДНК-маркера

    KASP (kompetitive allele specific PCR)
  • Структура праймеров (5’ – 3’)

    FAM: GTGCGAGACATCCAACACTCAC
    HEX: GTGCGAGACATCCAACACTCAT
    Com.Pr.: CTCAAATGGTCGAGCACAAGCTCTA
  • Условия амплификации

  • Длина фрагмента п.н.

Описание маркера

KASP-маркер при амплификации дает G аллель (FAM-аллель) или A аллель (HEX-аллель), связанные с присутствием гена Sr2, или нулевой аллель (без амплификации) (Mago et al., 2011).

Генотипирование образцов проводили KASP маркёром Sr2ger93p к гену Sr2. KASP-маркер изготовлен компанией LGC Biosearch Technologies (Великобритания). Амплификацию маркера и дискриминацию аллелей проводили с использованием прибора QuantStudio 5 (Applied Biosystems), а данные анализировали с использованием программного обеспечения для проектирования и анализа QuantStudioTM V2.6.0 (Applied Biosystems). Реакции генотипирования проводили в соответствии с рекомендациями по генотипированию «Guide to running KASP genotyping on the ABI 7500 instrument».

arrow_up [#337] Created with Sketch. Наверх