Sr22

  • Хромосома

    7A
  • Происхождение

    Triticum monococcum
  • Тест-линия

    SWSR22T.B.

Описание гена

Ген Sr22 первоначально был идентифицирован у диплоидных видов пшеницы: Triticum monococcum ssp. boeoticum образец G-21 и T. monococcum L. образец RL5244. Затем он был перенесен на тетраплоидную и гексаплоидную пшеницу путем межвидовой гибридизации. Ген Sr22 эффективен против Ug99. Однако снижение урожайности и задержка сроков колошения, связанные с T. monococcum ssp. boeoticum несущий Sr22, имеет ограниченное применение. Недавно были получены линии с Sr22 и редуцированными сегментами T. monococcum (Olson et al., 2010).


ДНК-маркеры

CFA2019

  • Тип ДНК-маркера

    SSR (simple sequence repeats)
  • Структура праймеров (5’ – 3’)

    F—GGATGATCGGTCAGTTGGTT
    R—TGTCTGCCTGTCTGTCGAAC
  • Условия амплификации

    Стадия денатурация: 95 ℃ — 3 мин. Стадия отжига праймеров (35 циклов): 94 ℃ — 45 сек. 60 ℃ — 45 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 5 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 238 п.н.
    S — 0 п.н.

Описание маркера

SSR-маркер CFA2019, фланкирующий ген Sr22 на расстоянии 5,9 сМ (Miranda et al., 2007).

arrow_up [#337] Created with Sketch. Наверх