Sr45

  • Хромосома

    1DS
  • Происхождение

    Aegilops tauschii
  • Тест-линия

    RL5289

Описание гена

Ген устойчивости к стеблевой ржавчине Sr45 происходит от Aegilops tauschii, предшественника D-генома Triticum aestivum. Этот ген был обнаружен в образце RL5289, который также был исходным материалом для гена устойчивости к листовой ржавчине Lr21 (Kerber, 1969). Восприимчивость Sr45 к некоторым канадским расам Puccinia gramininis spp. tritici исключает его использование в селекции. Однако Marais и соавт. в 1994 году показали, что Sr45 эффективен против южноафриканских рас патгена. В настоящее время Sr45 обеспечивает устойчивость к расе Ug99 и его семейству, а также эффективен против других рас P. graminins spp. tritici из Австралии, Индии и Южной Африки.

Поскольку и T. aestivum, и A. tauschii являются близкими родственниками, между ними относительно легко получить фертильные рекомбинанты. Эта характеристика много раз использовалась для переноса ценных генов от A. tauschii в пшеницу. Для этого есть две стратегии: с помощью синтетических сортов пшеницы с T. turgidum (донором геномов A и B) или прямого скрещивания между T. aestivum и A. tauschii с последующей интрогрессией в обоих случаях (Feuillet et al., 2008).

Ген Sr45 расположен на плече хромосомы 1DS, примерно в 10 mapping units proximal Sr33, другого гена устойчивости к стеблевой ржавчине. Sr45 уже присутствует у Thatcher + Lr21 (эталонный генотип для Lr21), Thornbill и AUS 18911.


ДНК-маркеры

cssu45

  • Тип ДНК-маркера

    SSR (simple sequence repeats)
  • Структура праймеров (5’ – 3’)

    F—CGAGTTTCAATACTTCGCCC
    R—GATTACTATGCAATAGGGCCC
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (40 циклов): 94 ℃ — 30 сек. 60 ℃ — 30 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 220 п.н.
    S — 238 п.н.

Описание маркера

В результате Periyannan et al., 2014 разработали кодоминантный ПЦР-маркер: cssu45, тесно связанный на уровне 0,39 сМ с Sr45. ПЦР-амплификация маркера cssu45 дает продукт амплификации 220 п.н. при наличии гена Sr45 и продукт 238 п.н., когда Sr45 отсутствует, включая образцы с Sr21 (происходящий от T. monococcum). Реакция на устойчивость линий несущие либо Sr45, либо Sr21, на многие расы возбудителя стеблевой ржавчины одинакова. Однако Sr21 неэффективен против Ug99 и нескольких родственных ему рас (Singh et al., 2011). Мы рекомендуем тщательно проверять генотипы родительских линий в своих программах селекции при выборе Sr45.

arrow_up [#337] Created with Sketch. Наверх