Sr36

  • Хромосома

    2BL
  • Происхождение

    Triticum timophevii
  • Тест-линия

    Sr36(CI12632)/8*LMPG

Описание гена

Ген устойчивости к стеблевой ржавчине Sr36, полученный из Triticum timopheevi, придает устойчивость к расе Ug99. Однако сообщалось, что другие расы вирулентны к Sr36, поэтому целесообразно использовать этот ген в группе с другими генами устойчивости.

Два сорта твердой краснозерной пшеницы: W1656 (CItr 12632) и W1657 (CItr 12633) были исходными источниками гена *Sr36. Среди генов, которые, как известно, обеспечивают устойчивость к Ug99 ген *Sr36* чаще встречается в селекционных линиях США. Он расположен на плече хромосомы 2BS. Bariana и соавторы 2001 описали десять связанных с ним молекулярных маркеров. Восемь из них были маркерами AFLP или RFLP, которые либо трудно воспроизвести, либо трудно использовать. Два других были микросателлитными маркерами, Xstm773 и Xgwm271. Первый дает лучшую амплификацию, чем второй, но продукты амплификации трудно подсчитать, что затрудняет дифференциацию между гомозиготными и гетерозиготными. Кроме того, для этого гена также доступен маркер KASP.


ДНК-маркеры

Xstm773

  • Тип ДНК-маркера

    STS (sequence tagged site)
  • Структура праймеров (5’ – 3’)

    F: AGGCTCAACACCACCCATAC
    R: AGGAGGAGGTGAAGGGGATA
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 10 мин. Стадия отжига праймеров (7 циклов): 94 ℃ — 60 сек. 64 ℃ — 60 сек. 72 ℃ — 60 сек. Стадия отжига праймеров (5 циклов): 94 ℃ — 60 сек. 57 ℃ — 60 сек. 72 ℃ — 60 сек. Стадия отжига праймеров (20 циклов): 92 ℃ — 30 сек. 55 ℃ — 60 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 10 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    S — 180 п.н.
    R — 0 п.н.

  • Тип ДНК-маркера

  • Структура праймеров (5’ – 3’)

  • Условия амплификации

  • Длина фрагмента п.н.

arrow_up [#337] Created with Sketch. Наверх