Sr15/Lr20

  • Хромосома

    7A
  • Происхождение

    Triticum aestivum
  • Тест-линия

    W2691*2/NORKA-SR15

Описание гена

Ген устойчивости к возбудителю стеблевой ржавчине пшеницы Sr15 (Watson & Luig, 1966) был определен как неэффективный по отношению к расе Pgt TTKSK и расам семейства Ug99 на основании восприимчивых типов инфекции проростков и полевых реакций моногенной линии Sr15 (Jin et al., 2007). Ранее было показано, что реакция гена Sr15 на авирулентные расы Pgt зависит как от температуры окружающей среды (Roelfs & McVey, 1979; Gousseau et al., 1985), так и от генетического фона культуры (Luig, 1983). В более ранних сообщениях указывалось, что Sr15 связан с геном устойчивости к мучнистой росе Pm1 и к гену устойчивости к листовой ржавчине Lr20 (Watson & Luig, 1966); McIntosh, 1977). Кроме того, ген корневой нематодоустойчивости Rlnn1 был картирован в том же месте, что и ген Sr15 (Williams et al., 2002; Jayatilake et al., 2013).


ДНК-маркеры

Xsts638

  • Тип ДНК-маркера

    STS (sequence tagged site)
  • Структура праймеров (5’ – 3’)

    F: TCGTCTGATCGTGAGAAACG
    R: GACGATTGCTGAGGATTGCT
  • Условия амплификации

    Стадия денатурация: 94 ℃ — 5 мин. Стадия отжига праймеров (36 циклов): 94 ℃ — 30 сек. 61 ℃ — 30 сек. 72 ℃ — 60 сек. Стадия элонгации: 72 ℃ — 7 мин. Хранение: 8 ℃ — ∞
  • Длина фрагмента п.н.

    R — 542 п.н.
    S — 0 п.н.
arrow_up [#337] Created with Sketch. Наверх